Review



hybridization solution expresshyb hybridization solution  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    TaKaRa hybridization solution expresshyb hybridization solution
    Hybridization Solution Expresshyb Hybridization Solution, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 3734 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+solution/ExpressHyb+Hybridization+Solution/us12606634-302-15-20
    Average 95 stars, based on 3734 article reviews
    hybridization solution expresshyb hybridization solution - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: The antivirulent Staphylococcal sRNA SprC regulates CzrB efflux pump to adapt its response to zinc toxicity.
    Article Snippet: Total RNA (15 μg) was separated on denaturing agarose gel 1% (1× MOPS, 2.2 M formaldehyde, 50% formamide) and transferred onto Nytran Hybond-XL membranes (Amersham) in 10× SSC. .. The membranes were hybridized with specific γ32P-labeled amplified DNA in ExpressHyb solution (Clontech), washed, exposed and scanned with a Typhoon FLA 9500 (GE Healthcare). .. Reverse transcription and qPCR assays Contaminating DNA was removed by DNase treatment (DNase amplification grade, Invitrogen), according to the manufacturer’s recommendations.

    Membrane:

    Article Title: Host cellular transcriptional response to respiratory syncytial virus infection in HEp-2 cells: insights from cDNA microarray and quantitative PCR analyses
    Article Snippet: .. Each array membrane was pre-hybridized in ExpressHyb solution (Clontech) to block non-specific binding, then hybridized overnight at 68°C with either the RSV-derived or mock-derived 32 P-labeled cDNA probe (each membrane receiving one probe, in parallel). ..

    Blocking Assay:

    Article Title: Host cellular transcriptional response to respiratory syncytial virus infection in HEp-2 cells: insights from cDNA microarray and quantitative PCR analyses
    Article Snippet: .. Each array membrane was pre-hybridized in ExpressHyb solution (Clontech) to block non-specific binding, then hybridized overnight at 68°C with either the RSV-derived or mock-derived 32 P-labeled cDNA probe (each membrane receiving one probe, in parallel). ..

    Binding Assay:

    Article Title: Host cellular transcriptional response to respiratory syncytial virus infection in HEp-2 cells: insights from cDNA microarray and quantitative PCR analyses
    Article Snippet: .. Each array membrane was pre-hybridized in ExpressHyb solution (Clontech) to block non-specific binding, then hybridized overnight at 68°C with either the RSV-derived or mock-derived 32 P-labeled cDNA probe (each membrane receiving one probe, in parallel). ..

    Hybridization:

    Article Title: tRF-3021a, a tRNA-Ala-TGC derived 3’ fragment, promotes glioblastoma cell invasion, suppresses apoptosis, and is required for normal levels of protein synthesis
    Article Snippet: RNAs were transferred to Amersham Hybond-N+ nylon membrane (Cytiva, RPN303B) using a Bio-Rad Trans-Blot semi-dry transfer apparatus at 200 mA for 1 h in 1X TBE. .. Membranes were UV-crosslinked and pre-hybridized in ExpressHyb solution (Takara, 636833) for ≥30 min at 42 °C, followed by hybridization in ExpressHyb at 42 °C with biotinylated DNA oligonucleotide probes targeting tRFs and U6 as a loading control. tRF probes were used at 50 pmol/mL, while tRNA and U6 probes were used at 10 pmol/mL: BIO-Leu-3009: /5BiosG/TGGTACCAGGAGTGGGGT BIO-Ala-3021: /5BiosG/TGGTGGAGATGCCGGGGATC BIO-Tyr-3030: /5BiosG/TGGTCCTTCGAGCCGGAATC U6 probe: /5BiosG/TGCGTGTCATCCTTGCGCAG Biotin-labeled probes were detected using the Thermo ScientificTM Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Fisher Scientific, 89880) according to the manufacturer’s instructions. ..

    Control:

    Article Title: tRF-3021a, a tRNA-Ala-TGC derived 3’ fragment, promotes glioblastoma cell invasion, suppresses apoptosis, and is required for normal levels of protein synthesis
    Article Snippet: RNAs were transferred to Amersham Hybond-N+ nylon membrane (Cytiva, RPN303B) using a Bio-Rad Trans-Blot semi-dry transfer apparatus at 200 mA for 1 h in 1X TBE. .. Membranes were UV-crosslinked and pre-hybridized in ExpressHyb solution (Takara, 636833) for ≥30 min at 42 °C, followed by hybridization in ExpressHyb at 42 °C with biotinylated DNA oligonucleotide probes targeting tRFs and U6 as a loading control. tRF probes were used at 50 pmol/mL, while tRNA and U6 probes were used at 10 pmol/mL: BIO-Leu-3009: /5BiosG/TGGTACCAGGAGTGGGGT BIO-Ala-3021: /5BiosG/TGGTGGAGATGCCGGGGATC BIO-Tyr-3030: /5BiosG/TGGTCCTTCGAGCCGGAATC U6 probe: /5BiosG/TGCGTGTCATCCTTGCGCAG Biotin-labeled probes were detected using the Thermo ScientificTM Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Fisher Scientific, 89880) according to the manufacturer’s instructions. ..



    Similar Products

    95
    TaKaRa hybridization solution expresshyb hybridization solution
    Hybridization Solution Expresshyb Hybridization Solution, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+solution/ExpressHyb+Hybridization+Solution/us12606634-302-15-20
    Average 95 stars, based on 1 article reviews
    hybridization solution expresshyb hybridization solution - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    TaKaRa expresshybtm hybridization solution
    Expresshybtm Hybridization Solution, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+solution/ExpressHyb+Hybridization+Solution/10__1016_slash_j__isci__2026__115782-470-9-12
    Average 95 stars, based on 1 article reviews
    expresshybtm hybridization solution - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    TaKaRa expresshyb solution
    Expresshyb Solution, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+solution/ExpressHyb+Hybridization+Solution/bio_rxiv__64898__2026__01__26__701835-71-6-8
    Average 95 stars, based on 1 article reviews
    expresshyb solution - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    TaKaRa expresshyb hybridization solution
    Expresshyb Hybridization Solution, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+solution/ExpressHyb+Hybridization+Solution/pmc12952294-39-0-4
    Average 95 stars, based on 1 article reviews
    expresshyb hybridization solution - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    TaKaRa expresshyb hybridization solution takara bio
    Expresshyb Hybridization Solution Takara Bio, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+solution/ExpressHyb+Hybridization+Solution/pm41417727-251-34-37
    Average 95 stars, based on 1 article reviews
    expresshyb hybridization solution takara bio - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    TaKaRa hybridization
    Hybridization, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+solution/ExpressHyb+Hybridization+Solution/us12473542-122-18-31
    Average 95 stars, based on 1 article reviews
    hybridization - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    TaKaRa hybridization solution
    Hybridization Solution, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+solution/ExpressHyb+Hybridization+Solution/us12473542-122-26-31
    Average 95 stars, based on 1 article reviews
    hybridization solution - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    TaKaRa hybridization oven
    Hybridization Oven, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+solution/ExpressHyb+Hybridization+Solution/pmc12851572-229-2-18
    Average 95 stars, based on 1 article reviews
    hybridization oven - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    Image Search Results